RICERCA ITALIANA     

Research program

Integrated approach to the identification of problematic taxa of the marine meiofauna: drafting of volumes of the series "Fauna d'Italia" and development and evaluation of methods of DNA-barcoding in Gastrotrichs, Proseriates and Rotifers

University Co-ordinator

Università degli Studi di MODENA e REGGIO EMILIA - BIOLOGIA ANIMALE - ()

Research Unit Leader

Mary Antonio Donatello Todaro

Description

The project aims to produce a volume, in English, of the series “Fauna d’Italia” devoted to the marine Gastrotricha. The Scientific Committee of the series has been contacted and has expressed wholehearted approval to the project.
The book will be supplemented with information useful to identify by mean of DNA-barcodes the most common species and those difficult to identify on the basis of the morphological characteristics only.
The financial support will enhance the qualitative standard of the equipment available to the team, but most important will make available fellowships intended for young researchers who are familiar with meiofauna and keen in learning taxonomy and systematic of meiofaunal organisms, aspects nowadays often neglected.

The Programme will be implemented as follows:
1. collection and elaboration of the material necessary for the drafting of the book, based on existing bibliography and the new data gathered during the 2005 intensive sampling campaigns performed under the sponsorship of the project Prin-2004 “Diversità e zoogeografia dei Gastrotrichi marini del Mediterraneo”.
According to the standards of “fauna d’Italia”, (see www.scienzemfn.uniroma1.it/faunait/Norme.html) the issue will be articulated as follows:
a) an introductory part with chapters devoted to morphology and biology, phylogentic relationships, ecology , techniques of collection, preparation and study, zoogeography and systematics of the taxon. In thi regard it should be highlighted that the proposing team possesses an exhaustive archive of all the papers published on Gastrotricha worldwide (see bibliography of the O.U. leader and at the www.gastrotricha.unimore.it) and has personal experience on all these topics (see bibliography of the OU's leader and at the web pag http://www.gastrotricha.unimore.it/bibliography.htm)The task will be here to make the whole introductory section of interest both to a reader already experienced in the field of taxonomy and systematics of the Gastrotricha, and to readers with different scientific background, who may face for the first time the study of this animal group. We feel that this aim is of particular importance, as this may constitute a cultural inheritance for future generations of researchers. To this aim, particular care will be devoted to the description of specific techniques which can only be acquired with extensive working experience on the group, such as techniques of collection and isolation from the sediment, preparation of slides of relaxed specimens for in vivo observation, preparation of the specimens for SEM survey, and, in case of hard bodied Gastrotricha, preparation of permanent slides, which may be send for assured identification to experts or may be used to set up local collections as points of reference. The general part will also include a chapter with the lists of the species present/common along the different tracts of the Italian and Mediterranean coastlines, with indication, as an aid to species determination, of their preference for sediment type, bathymetrical distribution and known ecological requirements.
b) A special part, where all the described Gastrotricha species known for the Mediterranean (as recommended by the Scientific Committee for the marine groups), will be presented. Members of this O.U. have (co)authored almost all the taxonomic papers (38 vs 40) dealing with marine Gastrotricha of Italy published since 1970; moreover, they have already produced checklists of Italian as well as Mediterranean Gastrotricha (e.g. Todaro et al., 2001, 2003b, 2006d), which will be used as bases upon which the new distributional data gathered from the surveys financially supported by the PRIN-2004 project will be added, as well as the several new species, presently in preparation for publication (see “species card” below). Species descriptions, as well as the sections devoted to the higher ranking taxa, will be written according to the editorial rules of the “Fauna d’Italia”. Similarly to the general part, in preparing descriptions and figures a particular emphasis will be given to characteristics allowing identification of living and/or fixed organisms. Identification keys will also be produced, especially pictorial keys, which may result in particularly useful for non-expert taxonomists. What follow below is an example of the “species' cards” that will constitute the main corpus of the intended book. Currently an estimate of about 180 species/cards will be included in the book dealing with taxa of both Orders, Macrodasyida (7 families and 29 genera) and Chaetonotida (4 families e 12 genera).

2) During the first year, a series of additional sampling will be carried out in few sectors of the Italian coastline poorly surveyed with regard to the gastrotrich fauna. During these new sampling campaigns, primarily attention will be paid to habitats that recent studies have found of great interests, such as submerged caves, calcareous sediments(clastic and organogenous), deep sublittoral sediments i.e. 15 m water depth (Todaro & Leasi 2006; Todaro et al. 2006b,c).
These sampling campaigns will not only fill the gap on distributions, but may also reveal, as already often happened, new species. It is worth noting that the existence nowadays of journal with rapid publication times, may allow for the inclusion in the book o new species eventually found during the first year of the project.

3) During the first year, the species to be used to develop and evaluate the methods of identification of gastrotrichs based on the DNA-barcode approach will also be collected.
For this purpose at least 5 specimens of 20 species, belonging to a broad phylogenetic spectrum, but with some species being co-generic, will be fixed in absolute alcohol and stored at -80° C separately.
Subsequently, for each species will extract the DNA from three specimens selected at random. We must stress that during preliminary investigations conducted on two small species, Polymerurus nodicaudus and Aspidiophorus polystictos, we were able to extract of good quantities of DNA from single individuals using the extraction kits normally on the market (e.g. Qiagen dneasy tissue kit).
In subsequent phases we will proceed with the amplification via PCR, of the mitochondrial gene COI, more specifically we will amplify and sequence the so-called " Folmer region ". This region, formed, in many cases from about 650 bp can be amplified using the universal primers indicated by Folmer et al. (2004):
LCO1490: 5'-GGTCAACAAATCATAAAGATATTGG -3’
HCO2198: 5'- TAAACTTCAGGGTGACCAAAAAATCA -3'
The rationale for using in the first place the Folmer region lies in the fact that it has been accepted by Consortium for the Barcode of Life (cBOLl) as the default barcoding region; therefore, its adoption also in the process of gastrotrich DNA-barcoding would yield a wide range of benefits.
However, in the event that this region does not meet the requirements of the barcoding approach (see, Guidelines for CBOL Approval of Non-COI Barcode Regions http://barcoding.si.edu/PDF/Guidelines%20for%20non-CO1%20selection%20-%204%20June.pdf we will evaluate the possibility of using to this end the ribosomal gene 18S rRNA. In this case we would amplify and sequence the whole gene following the protocol by Todaro et al. (2006a).
The sequences obtained, along with the ones already available in GeneBank, will be aligned and examined in the search for a region suitable for barcoding: i.e. not exceeding the 700 pb, variable enough to allow the discrimination of the species under study; this ideal region should also be flanked by highly conserved regions, from with to derive the highly specific primers to be use in further testing. This procedure has already been used for other groups (e.g. nematodes) in which the COI gene had not given the expected results (Bhadury et al. 2006).
We would like to enfasize that the molecular part of the research will be carried out in full cooperation with the Prof. Ulf Joundelius, Chairman of the Department of Invertebrate Zoology (Swedish Museum of Natural History) and his group, with which we are already collaborating on similar subjects regarding the freshwater gastrotrichs of Sweden (see the letter below).




Esemplificative species’ card:
Pseudostomella gigas (Todaro, Dal Zotto & Tongiorgi, in pubblicazione)
Figs (1-4)

Todaro MA, Dal Zotto M, Tongiorgi P. 2007 – Three new Thaumastodermatidae (Gastrotricha, Macrodasyida) from Italian marine protected areas. (in press)

Type locality: Grotta delle Corvine, Marine protected area of Porto Cesareo (Lecce, Italy; Lat. 40°16’14,0”N, Long 17°51’12,9’’ E; Fig. 4)

Description
Body somewhat slender, slightly swollen in the posterior pharyngeal region and at the base of the 43 µm-long caudal pedicles. Pharynx 81 µm in length, measured from the ventral border of the oral opening to the pharyngeo-intestinal junction; pharyngeal pores near the base, at U29.5; pharyngeo-intestinal junction at U32; widths of neck/PhIJ/trunk/caudal base 30/29/54/31 µm at U15/U31/U51/U82, rispectively.
Head with well developed, fleshy preoral palps, incurving ventromedially; the dorsal border projecting just beyond the ventral. Sensory hairs and papillae occur on dorsal and ventral borders of the preoral palps; hairs are scattered on the dorsal, lateral and ventral surface of the palps; dorsally there are 5 papillae, nearly same in length (8-10 µm), symmetrically arranged along the inner border of the palps in a 2 + 1 + 2 pattern; ventrally, there are eight papillae, 5-8 µm in length, symmetrically arranged more centrally about the inner border of the palps in a 4 + 4 pattern; all papillae bearing one or two, short sensory hairs at their tip; other hairs form lateral columns that are evenly spaced from U12.5 to U85; individual hairs are 12-15 µm in length. Glands barely visible, variable in shape (oval to oblong) and size (4-8 µm in diameter), asymmetrically scattered along most of the length of the body.
Cuticular armature: small sized pentancres with delicate, curved grasping tines, as tall as wide (3 x 3 –5 x 5) on whole dorsal and ventrolateral surface, except for a bare, roughly T-shaped area posterior to the palps; posteriorly most ancres extend onto the caudum.
Adhesive tubes: TbA, 2 per side (7-8 µm in length) in a row at U7.8; TbL, 1 per side (15-18 µm in length), robust, inserting on the posteriorlateral margin at U83.5; TbVL, 11 per side, 2 smaller ones (9-11 µm in length) in the anterior pharyngeal region, roughly at U16, 7 of slightly variable size and length (11-16 µm in length), irregularly spaced in the intestinal region from U33.5 to U71.5, the remainder 2, of unequal length (10 and 14 µm ), originate from a common base at U76.2; TbP, 4 per side, 2 + 1 (5-6 µm in length) at the end of each foot of the furcated caudum and the other one (10 µm in length) flanking each foot medially.
Ventral locomotor cilia: a continuous field of transverse rows covering sparsely the entire surface from U12 to U35; the field splits in the anterior intestinal region to form paired lateral tufts that extend onto the ano-genital area at U84. Reproductive system: testis on the right body side, caudal organ inverted pyriform (11 x 22 µm ), at U78; frontal organ bladder-like (9 µm in diameter), at U74.5; maturing eggs mid-dorsally above the posterior half of the intestine.

Measurement and variability
Body length of adult specimens (i.e., showing at least the testicles filled with sperm) ranges from 340 to 425 µm. The adhesive tubes of the TbVL series shows some variability in number, depending on individuals, ranging 11-15; however, the one borne on a common base number invariably two per side. Some specimens may bear 3-4 tubes of “cirrata” type along each dorsolateral side of the trunk region.

Diagnostic characters: Large body size (exceeding 400 µm); body covered by pentancres; preoral palps provided with 5 and 8 papillae on the dorsal and ventral border respectively; presence of a bare, roughly T-shaped area posterior to the palps, on the dorsal side; on each side: 2 TbA; 1 TbL, at the rear end; 11 TbVL, the two posteriormost borne on common base; 4 TbP, three of which at the end of the pedicles; caudal organ pyriform; frontal organ bladder –like.
Closest Italian species: Pseudostomella etrusca Hummon, Todaro & Tongiorgi, 1992

Geographic distribution (Fig 1): Mediterranean Sea: Italy – Sardinia: Alghero, off Punta di Capo Caccia; Apulia: Lecce, off of Porto Cesareo.




Fig. 1. Pseudostomella gigas – Drawing of the habitus, ventral view. Co, Caudal organ; Cp, caudal pedicles; Dp, dorsal papillae; E, egg; Fo, Frontal organ; PhIJ, Pharingeo-intestinal junction; Pp, Pharyngeal pores; T, testicle; TbA, Anterior adhesive tubes; TbL, Lateral adhesive tubes; TbVL, Ventrolateral adhesive tubes; Vp, Ventral papillae. Bar = 100 um



Fig. 2. Pseudostomella gigas. DIC micrographs. A, Habitus; B, close-up of the anterior region, dorsal view; C, Close-up of the anterior region, ventral view. Bars, A, 100 um; B, C, 50 um.



Fig. 3. Pseudostomella gigas. SEM micrographs. A, habitus, dorsal view; B, habitus, ventral view; C, close-up pf the anterior region, dorsal view; D, close up of the anterior region, ventrolateral view; E, close-up of the posterior region, dorsal view; F, close-up of the posterior region, ventral view, arrow shows the two ventrolateral adhesive tubes born from a comnon base. Bars, A, B, 50 um; C-F,25 um.



Fig. 4. Known distribution of the species

SYNERGIES WITH ONGOING INVESTIGATION OF THE RESEARCH UNIT
Discovery of poorly known species of major systematic interest (basal taxa, such as, Dactylopodola, Musellifer, Paradasya, Xenodasys) which are rare in littoral sediment but probably present in caves and deper sublittoral sediments would permit in-depth analyses, on ultrastructural and molecular bases, of the phylogenetic relationships among gastrotrich taxa and between these and other lower Metazoa phyla (Leasi et al., 2006; Todaro et al. 2003a, 2006a;). Comparison with data from geographically distant submarine caves, which are currently been investigated (Todaro e Shirley 2003, Todaro et al. 2006b,c) should allow the recognition of species or communities genuinely troglobial and formulate hypotheses about caves as refuge and as sink of biodiversity for meiofaunal organisms. Moreover, ecological data regarding the Gastrotricha of the calcareous sediments will integrate the outcomes of an ongoing study by an international team, aimed at verify on comparative grounds, the generally accepted , but yet to be tested, notion that sees siliceous and calcareous sands as two different worlds for meiofaunal organisms (Giere et al. 2004; Todaro & Dal Zotto in prep.).

CULTURAL GAINS
Information with didactical value (e.g., picture gallery of the species found, typically unfamiliar to the general public) and/or useful for a sound management of marine environment (check-list of the present taxa, records of rare or endangered species etc.) will be offered to the entire community by web publication in the Gastrotricha World Portal “www.gastrotricha.unimore.it”, which is managed by researchers of this O.U. Digital video pictures of the species found will contribute to the enrichment of the “Video database for marine Gastrotricha of the world" currently under construction (Hummon et al. 2005).